Exercise 2: Adding a 5` extension

A 5` extension is a short stretch of sequence at the 5` end of the primer that does not match the template. Examples of 5` extensions include restriction sites or cloning-specific sequences, where the aim is to produce a PCR product which can then be cloned into a vector, or sequencing barcodes and adaptors which enable PCR products to be sequenced using high-throughput sequencing. In Geneious, 5' extensions are annotated separately so that this sequence will not be considered when testing primers against a target.

In this exercise, you will turn the primers we designed in Exercise 1 into fusion primers suitable for 454 Amplicon sequencing by adding a sequencing adaptor to their 5` ends. Select the forward primer you extracted in exercise 1. Click the Primers button from the menu options and select Add 5` extension. Click Bases. The sequencing adaptor we wish to add has two components - a 454 adaptor called "Primer A" (added to the forward primer) or "Primer B" (added to the reverse primer) and a linker sequence consisting of a 4 base pair tag. To add these, click Bases and paste the sequence of Primer A below into the bases box. Type Primer A next to Name and click OK.

Primer A: CGTATCGCCTCCCTCGCGCCA

Click the Bases box again, remove the Primer A sequence already there and type "TCAG" into the box. Type Linker next to Name and click OK. In the box you'll see a visual representation of how the 5` extensions are arranged. It should look as in the screenshot below. You can reorder the extensions if you wish just by dragging and dropping them in this window.

Click OK and you will now see the primer displayed with Primer A and Linker sequences added to the 5` end. Click Save to update the primer. Repeat this process for the reverse primer, but this time add the Primer B sequence given below.

Primer B: CTATGCGCCTTGCCAGCCCGC


Notes

Exercise 3: Testing saved primers
Exercise 4: Degenerate primer design

Back to Start